Table 5. Multidrug resistant profile of V. cholerae isolated from raw vegetable samples
Table 5. Multidrug resistant profile of V. cholerae isolated from raw vegetable samples From: Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh No. of Pattern No. of antibiotic classes Multidrug resistance profiles of S. aureus No. of isolates showed resistant n (%) Overall […]
Table 4. Multidrug resistant profile of E. coli isolated from raw vegetable samples.
Table 4. Multidrug resistant profile of E. coli isolated from raw vegetable samples. From: Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh No. of Pattern No. of antibiotic classes Multidrug resistance profiles of E. coli No. of isolates showed resistant n (%) Overall […]
Table 3. Overall Molecular prevalence of 16S rRNA gene of E. coli and groEL gene of V. cholerae isolated from raw vegetables.
Table 3. Overall Molecular prevalence of 16S rRNA gene of E. coli and groEL gene of V. cholerae isolated from raw vegetables. From: Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh Name of the organisms Name of the genes Number of detected isolates […]
Table 2. Total Viable Count (TVC) of vegetable samples from different markets in Dinajpur district.
Table 2. Total Viable Count (TVC) of vegetable samples from different markets in Dinajpur district. From: Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh Name of the samples Number of the samples TVC (mean log CFU ± SD/gm) Potato 6 2.4 ± […]
Table 1. Primers used for the molecular detection E. coli and Vibrio spp.
Table 1. Primers used for the molecular detection E. coli and Vibrio spp. From: Molecular detection and antibiogram profiles of Escherichia coli and Vibrio cholerae isolated from raw vegetables in the northern district of Bangladesh Name of primers Sequence (5′-3′) Amplicon size (bp) reference 16S rRNA F: AATTGAAGAGTTTGATCATG 704 bp Sarker et al. (2018) R: CTCTACGCATTTCACCGCTAC […]
Table 4. The sequences of the Anisoptera species from Basrah Province were submitted to GenBank and IBIN.
Table 4. The sequences of the Anisoptera species from Basrah Province were submitted to GenBank and IBIN. From: Molecular identification of some species of dragonfly (Odonata: Anisoptera) using COXI gene and DNA barcodes from Basrah Province, Southern Iraq Species Target gene Product size GenBank accession numbers IBIN (Barcodes ID) Orthetrum sabina adult mtCOX1 285 […]
Table 3. Similarity percentage of mtCOX1 for the selected species of Anisoptera from Basrah Province, with the accession numbers of similar species in the GenBank database.
Table 3. Similarity percentage of mtCOX1 for the selected species of Anisoptera from Basrah Province, with the accession numbers of similar species in the GenBank database. From: Molecular identification of some species of dragonfly (Odonata: Anisoptera) using COXI gene and DNA barcodes from Basrah Province, Southern Iraq Species Target gene GenBank accession number Similarity […]
Table 2. Concentration and purity of the genetic material (DNA) extracted via NanoDrop.
Table 2. Concentration and purity of the genetic material (DNA) extracted via NanoDrop. From: Molecular identification of some species of dragonfly (Odonata: Anisoptera) using COXI gene and DNA barcodes from Basrah Province, Southern Iraq Sample Purity Conc. ng/µ Sample Purity Conc. ng/µ Sample Purity Conc. ng/µ 1 1.91 7.7 11 1.78 7.0 21 1.81 […]
Table 1. Details of selected species of Dragonflies, target genes and nucleotide sequence primers used in this study.
Table 1. Details of selected species of Dragonflies, target genes and nucleotide sequence primers used in this study. From: Molecular identification of some species of dragonfly (Odonata: Anisoptera) using COXI gene and DNA barcodes from Basrah Province, Southern Iraq Species Gene Primer Length Product size Tm. Crocothemis erythraea mtCOX1 F GTTATTGTAACCGCCCATGC R GGGTAGACTGTTCACCCAGT 20 […]
Table 5. Arsenic bioaccessibility of ZZH soil in the gastrointestinal phases.
Table 5. Arsenic bioaccessibility of ZZH soil in the gastrointestinal phases. From: Evaluation of nutrients effect on the arsenic bioaccessibility of contaminated soil Treatment Gastric Phase Intestine Phase Colon Phase Control 2.26 ± 0.32 d 25.14 ± 2.14 c 9.92 ± 0.72 c Glucose 25.16 ± 0.51 a 53.51 ± 3.30 ab 15.30 ± 0.94 […]
